Effect of dietary porphyran from the red alga, Porphyra yezoensis, on glucose metabolism in diabetic KK-Ay mice.
نویسندگان
چکیده
Porphyran (POR) from the red alga Porphyra yezoensis is a water soluble dietary fiber. In this study, we investigated the effect of dietary POR on glucose metabolism in KK-Ay mice (a model for type 2 diabetes). Mice were divided into 4 groups and fed a diet containing 5% cellulose (control), POR, POR Arg or POR K. After 3 wk of feeding, plasma insulin levels and the calculated homeostasis model assessment-insulin resistance (HOMA-IR) index were significantly lower in the POR group than in the control group. Compared with the control group, plasma adiponectin levels were significantly increased in the POR, POR Arg and POR K groups. These results suggest that dietary POR should improve glucose metabolism in diabetes via up-regulation of adiponectin levels. In addition, the amount of propionic acid in the cecum of the POR group was significantly higher than in the control group and the profile of bacterial flora was changed by dietary POR. In the cecum of the POR, POR Arg and POR K groups, Bacteroides was significantly increased and Clostridium coccoides was significantly decreased compared with in the control group. The effects of dietary POR on the hindgut environment might contribute to the improvement of glucose metabolism.
منابع مشابه
Isolation of porphyran-degrading marine microorganisms from the surface of red alga, Porphyra yezoensis.
Marine microorganisms degrading porphyran (POR) were found on the surface of thalli of Porphyra yezoensis. Fifteen crude microorganism groups softened and liquefied the surface of agar-rich plate medium. Among these, 11 microorganism groups degraded porphyran that consisted of sulfated polysaccharide in Porphyra yezoensis. Following isolation, 7 POR-degradable microorganisms were isolated from ...
متن کاملInhibitory effect of sulphated polysaccharide porphyran on nitric oxide production in lipopolysaccharide-stimulated RAW264.7 macrophages.
Porphyran, extracted from an edible red alga (Porphyra yezoensis), is a sulphated polysaccharide with a wide variety of biological activities including anti-tumour, antioxidant and immuno-modulating activities. In this study, we examined the effect of porphyran on nitric oxide (NO) production in mouse macrophage cell line RAW264.7 cells. Although no significant activity of porphyran to induce N...
متن کاملAnti-diabetic effect of pyroglutamic acid in type 2 diabetic Goto-Kakizaki rats and KK-Ay mice.
With the rapidly increasing prevalence of type 2 diabetes mellitus (T2DM), specific dietary components with anti-diabetic efficacy could be one strategy with therapeutic potential. In the present study, the anti-diabetic effects of an amino acid, pyroglutamic acid (PA), found in vegetables and fruits were investigated in T2DM models using Goto-Kakizaki (GK) rats and KK-Ay mice by measuring gluc...
متن کاملThe nucleotide sequence of 5S rRNA from a red alga, Porphyra yezoensis.
The nucleotide sequence of 5S rRNA from Porphyra yezoensis has been determined to be: pACGUACGGCCAUAUCCGAGACACGCGUACCGGAACCCAUUCCGAAUUCCGAAGUCAAGCGUCCGCGAGUUGGGUUAGU - AAUCUGGUGAAAGAUCACAGGCGAACCCCCAAUGCUGUACGUC. This 5S rRNA sequence is most similar to that of Euglena gracilis (63% homology).
متن کاملCharacterization of short interspersed elements (SINEs) in a red alga, Porphyra yezoensis.
Short interspersed element (SINE)-like sequences referred to as PySN1 and PySN2 were identified in a red alga, Porphyra yezoensis. Both elements contained an internal promoter with motifs (A box and B box) recognized by RNA polymerase III, and target site duplications at both ends. Genomic Southern blot analysis revealed that both elements were widely and abundantly distributed on the genome. 3...
متن کاملذخیره در منابع من
با ذخیره ی این منبع در منابع من، دسترسی به آن را برای استفاده های بعدی آسان تر کنید
برای دانلود متن کامل این مقاله و بیش از 32 میلیون مقاله دیگر ابتدا ثبت نام کنید
ثبت ناماگر عضو سایت هستید لطفا وارد حساب کاربری خود شوید
ورودعنوان ژورنال:
- Journal of nutritional science and vitaminology
دوره 58 1 شماره
صفحات -
تاریخ انتشار 2012